View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7174_low_16 (Length: 239)
Name: NF7174_low_16
Description: NF7174
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7174_low_16 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 1 - 224
Target Start/End: Complemental strand, 32886450 - 32886222
Alignment:
| Q |
1 |
attttataagaggtgagttgttttgaaaagtctttggtacaaaatggttgaatgggtatatgttgaggaatcaaataacgactaaacaaacacttagaac |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||| |
|
|
| T |
32886450 |
attttataagaggtgagttgttttgaaaagtctttggtacaaaatggttgaatgggtatatgttggggaatcaactaacgactaaacaaacacttagaac |
32886351 |
T |
 |
| Q |
101 |
ac-----gctcatcgatagttaataactgttcaacagcaaacgatagttaactaccgtttaaagtaatctttttaaatgcatgtgagtaattgctaggtg |
195 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||| ||||||| ||| ||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
32886350 |
actctcatctcatcgatagttaataactgttcaacagcaaacggtagttaaatacagtttaaagtaatctttttaaatgcatgtgagtaattgttaggtg |
32886251 |
T |
 |
| Q |
196 |
tctaaagagcaatctccatggtacaaatt |
224 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
32886250 |
tctaaagagcaatctccatggtacaaatt |
32886222 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University