View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7174_low_8 (Length: 337)
Name: NF7174_low_8
Description: NF7174
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7174_low_8 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 325; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 325; E-Value: 0
Query Start/End: Original strand, 1 - 337
Target Start/End: Original strand, 32557431 - 32557767
Alignment:
| Q |
1 |
gcacctcccatatttgttcccaacatttgattattataacagtcttctgatgcattctgctcccatgatgaataaaaataaccatgatcgcctccgttga |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32557431 |
gcacctcccatatttgttcccaacatttgattattataacaatcttctgatgcattctgctcccatgatgaataaaaataaccatgatcgcctccgttga |
32557530 |
T |
 |
| Q |
101 |
atactgaatcacctggactataacaggcagagctagtaatatccggtggcaacggaggaagctcaacattgtcgttgttaaaataggaatttccattgtt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
32557531 |
atactgaatcacctggactataacaggcagagctagtaatatccggtggcaacggaggaagctcaacattgtcgttgttaaaataggaatttccattatt |
32557630 |
T |
 |
| Q |
201 |
attaatgttattaatactagcctccaatgtatcaagaggaacttgatgaggaagactgtatttattgaaataattattatcatttccctcaccgtaaccg |
300 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32557631 |
attaatgttattaataccagcctccaatgtatcaagaggaacttgatgaggaagactgtatttattgaaataattattatcatttccctcaccgtaaccg |
32557730 |
T |
 |
| Q |
301 |
taactcccagaggaagttatgattgaaaccgggtcga |
337 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32557731 |
taactcccagaggaagttatgattgaaaccgggtcga |
32557767 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University