View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7175_low_10 (Length: 242)
Name: NF7175_low_10
Description: NF7175
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7175_low_10 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 71; Significance: 3e-32; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 1 - 122
Target Start/End: Complemental strand, 41564015 - 41563892
Alignment:
| Q |
1 |
ttttttatggagtatattacaccttcattaagaaaatgcctatgg---tgggaatgtgaagagtcgcttgtacggtgttggtggtctttttcagcaacct |
97 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| | | | ||||||||||||||||||||||||||| | |||||||||||||| |
|
|
| T |
41564015 |
ttttttatggagtatattacaccttcattaagaaaatgcctattgcattcaataaatgaagagtcgcttgtacggtgttggtgtt-tttttcagcaacct |
41563917 |
T |
|
| Q |
98 |
ttagccatcacgatttatggagttc |
122 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
41563916 |
ttagccatcacgatttatggagttc |
41563892 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 29; Significance: 0.0000003; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 189 - 217
Target Start/End: Complemental strand, 885018 - 884990
Alignment:
| Q |
189 |
cctccgatctcaaatgtaagaaacttttc |
217 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
885018 |
cctccgatctcaaatgtaagaaacttttc |
884990 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 183 - 223
Target Start/End: Original strand, 22012585 - 22012625
Alignment:
| Q |
183 |
atatttcctccgatctcaaatgtaagaaacttttcgctttt |
223 |
Q |
| |
|
||||| ||||| ||||||||||||||||||||||| ||||| |
|
|
| T |
22012585 |
atattccctccaatctcaaatgtaagaaacttttcactttt |
22012625 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University