View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7175_low_8 (Length: 255)
Name: NF7175_low_8
Description: NF7175
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7175_low_8 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 20 - 245
Target Start/End: Original strand, 939313 - 939540
Alignment:
| Q |
20 |
agtagaagataaggccattattagagtttaaatcgtttgtttggtttggtttcactttcagacatat--atattggtttggtttcgtattttcatttgca |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
939313 |
agtagaagataaggccattattagagtttaaatcgtttgtttggtttggtttcactttcagacatatatatattggtttggtttcgtattttcatttgca |
939412 |
T |
 |
| Q |
118 |
catgtgggtgtctagagtccagtgcattcctctcaaattttgacggttagattcatgttatacttttatatccgatggttgatattttatttgactgggg |
217 |
Q |
| |
|
||||||||||||||||||||||||| |||| |||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
939413 |
catgtgggtgtctagagtccagtgcgttccactcaaattttgacggttagatttatgttatacttttatatccgatggttgagattttatttgactgggg |
939512 |
T |
 |
| Q |
218 |
actcaaacagaggatctaggtgtctgtg |
245 |
Q |
| |
|
||||||||||||||||||||||| |||| |
|
|
| T |
939513 |
actcaaacagaggatctaggtgtgtgtg |
939540 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University