View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7176_low_5 (Length: 250)
Name: NF7176_low_5
Description: NF7176
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7176_low_5 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 153; Significance: 3e-81; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 13 - 249
Target Start/End: Complemental strand, 27372152 - 27371909
Alignment:
| Q |
13 |
aatataatgttattttattttgaaatttgaagaaatcaaca-------acatcaaattaggaatagtagtaaaagtttatggtcattcaactcaaaagta |
105 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
27372152 |
aatatcatgttattttattttgaaatttgaagaaatcaacattcaacaacaccaaattaggaatagtagtaaaagtttatggtcagtcaactcaaaag-- |
27372055 |
T |
 |
| Q |
106 |
ctctaacacc---acacctttacaaatttacatagtagacccaactaccctttaatttcacgtccatacttcaaataaaattttgtaatggctttgtttc |
202 |
Q |
| |
|
||||||||| ||||||||||||||||| ||||| ||||| ||||||||||||||||||||||||||||||| ||||||||||||||||| ||| || |
|
|
| T |
27372054 |
-tctaacacctcatcacctttacaaatttacctagtacacccacctaccctttaatttcacgtccatacttcaaacaaaattttgtaatggctctgtatc |
27371956 |
T |
 |
| Q |
203 |
cctttgtttgttgtcttattgtcataattgtatcccaagccaaagcc |
249 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27371955 |
cctttgtttgttgtcttattgtcataattgtatcccaagccaaagcc |
27371909 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University