View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7176_low_7 (Length: 205)
Name: NF7176_low_7
Description: NF7176
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7176_low_7 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 153; Significance: 3e-81; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 10 - 203
Target Start/End: Complemental strand, 52233176 - 52232983
Alignment:
| Q |
10 |
agataatacttactggaagcagaaggtactgatattcaatttttcaatgatggagttcacnnnnnnnnnnnaacgtttgtgacagatcagtagtcatgct |
109 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
52233176 |
agatattacttactggaagcagaaggtactgatattcaatttttcaatgatggagttcacttttcttttttaacgtttgtgacagatcagtagtcatgct |
52233077 |
T |
 |
| Q |
110 |
tgactattgacacttagtcacgacacttccataggaattatgatggaaattagtacattgcagcgatgctttagatttttgtgatgatgtccat |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
52233076 |
tgactattgacacttagtcacgacacttccataggaattatgatggaaattagtacattgcagcgatgctttagatttttgtgatggtgtccat |
52232983 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 126 - 203
Target Start/End: Original strand, 51528064 - 51528140
Alignment:
| Q |
126 |
gtcacgacacttccataggaattatgatggaaattagtacattgcagcgatgctttagatttttgtgatgatgtccat |
203 |
Q |
| |
|
|||||||| |||||| | |||| |||| |||||||||| |||||| | ||| ||||||||||||||||| ||||||| |
|
|
| T |
51528064 |
gtcacgacgcttccaaatgaatcttgatagaaattagtaaattgcatcaatg-tttagatttttgtgatggtgtccat |
51528140 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University