View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7177_high_3 (Length: 250)
Name: NF7177_high_3
Description: NF7177
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7177_high_3 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 1 - 247
Target Start/End: Original strand, 37662444 - 37662690
Alignment:
| Q |
1 |
ctttgcaaagggaagtattacaaggtggctctgatttcattcgttcaccaacttgtccttcattcaagacaaattcaacatatgaagttggtgatttcaa |
100 |
Q |
| |
|
|||||||| | ||||| ||||||||||| |||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||| |
|
|
| T |
37662444 |
ctttgcaacgtgaagttttacaaggtggttctgatttcattcgttcaccaacttgtccttcattcaaaaccaattcaacatatgaagttggtgatttcaa |
37662543 |
T |
 |
| Q |
101 |
gaactttgttgaatggaacaaggttgttcagttacttggttcaaaagggtattcttcattttcaactgcattgcattctgttcttgaagggattctgaaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
37662544 |
gaactttgttgaatggaacaaggttgttcagttacttggttcaaaagggtattcttcattttcaactgcattgcattctgttctcgaagggattctgaaa |
37662643 |
T |
 |
| Q |
201 |
gattcatcaagttttggttatggttctgctacaatctctgctactcc |
247 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||| |||| |
|
|
| T |
37662644 |
gattcatcaagttttggttatggttctgctacaatctttgctcctcc |
37662690 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University