View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7178_high_19 (Length: 243)
Name: NF7178_high_19
Description: NF7178
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7178_high_19 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 17 - 227
Target Start/End: Complemental strand, 49563496 - 49563286
Alignment:
| Q |
17 |
catcatgtaaaggattgaaagaaccaggcagtattattttcctttctgctggtatctctgaaaccagagaataaaaaattatcaataacaaagtaaatcg |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49563496 |
catcatgtaaaggattgaaagaaccaggcagtattattttcctttctgctggtatctctgaaaccagagaataaaaaattatcaataacaaagtaaatcg |
49563397 |
T |
 |
| Q |
117 |
tcattgtaactgtaataatattgcttctgcacaaaggtttaactataccacttctaaatggataaatcttgaagcatatttgaccatttataagttgctc |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49563396 |
tcattgtaactgtaataatattgcttctgcacaaaggtttaactataccacttctaaatggataaatcttgaagcatatttgaccatttataagttgctc |
49563297 |
T |
 |
| Q |
217 |
taactcttgat |
227 |
Q |
| |
|
||||||||||| |
|
|
| T |
49563296 |
taactcttgat |
49563286 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University