View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7178_high_21 (Length: 222)
Name: NF7178_high_21
Description: NF7178
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7178_high_21 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 119; Significance: 6e-61; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 119; E-Value: 6e-61
Query Start/End: Original strand, 6 - 165
Target Start/End: Original strand, 4739070 - 4739233
Alignment:
| Q |
6 |
gggttatcgttttaatcaaaaccggaaaattgactatgcaaaagcaacaatggaggtggactgtgcagaccggttatggacatacatagat----aaaag |
101 |
Q |
| |
|
|||||||| |||||||| |||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||| ||||| |
|
|
| T |
4739070 |
gggttatcactttaatcagaaccggaaaattgactatgcaaaagcaacaatgggggtggactatgcagaccggttatggacatacatagataaaaaaaag |
4739169 |
T |
 |
| Q |
102 |
gctttaaatatattccttaacttattttaagttaggtcatataactttaaaaccactctctctc |
165 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||| |
|
|
| T |
4739170 |
gctttaaatatattccttaacttattttcagttaggtcatataactttaaaaccaatctctctc |
4739233 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University