View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7178_high_4 (Length: 402)
Name: NF7178_high_4
Description: NF7178
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7178_high_4 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 148; Significance: 5e-78; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 148; E-Value: 5e-78
Query Start/End: Original strand, 36 - 199
Target Start/End: Complemental strand, 38470614 - 38470451
Alignment:
| Q |
36 |
gtccctttcgagttaacacaaccttacccttttgggtttttgaaatcggtcagaccctttcgggtttttgaaattgaaccacatcaaaacggccacaaat |
135 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||| |
|
|
| T |
38470614 |
gtccctttcgagttaacacaaccttacccttttgggtttttgaaatcggtcagaccctttcgggtttttgaaattgaaccacatcaaaacgactacaaat |
38470515 |
T |
 |
| Q |
136 |
ctaatgccacccaatctctgatcaataacaaaagcaaacaaacatgtaccaaacaattgtcggc |
199 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
38470514 |
ctaatgccacccaatctctggtcaataacaaaagcaaacaaacatgtaccaaacaactgtcggc |
38470451 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 317 - 382
Target Start/End: Complemental strand, 38470351 - 38470286
Alignment:
| Q |
317 |
caccaccgaccggtcatccaccggcgcgagctcaaacaacaacgtcgagaacatcattttatgaag |
382 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
38470351 |
caccaccgaccggtcatccaccggcgcgagctcaaacaacaccgtcgagaacatcattttatgaag |
38470286 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 38 - 82
Target Start/End: Complemental strand, 52148817 - 52148773
Alignment:
| Q |
38 |
ccctttcgagttaacacaaccttacccttttgggtttttgaaatc |
82 |
Q |
| |
|
|||||||| ||||||| |||| ||||||||| ||||||||||||| |
|
|
| T |
52148817 |
ccctttcgggttaacataaccatacccttttaggtttttgaaatc |
52148773 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 54; Significance: 7e-22; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 69 - 190
Target Start/End: Complemental strand, 4724334 - 4724216
Alignment:
| Q |
69 |
gggtttttgaaatcggtcagaccctttcgggtttttgaaattgaaccacatcaaaacggccacaaatctaatgccacccaatctctgatcaataacaaaa |
168 |
Q |
| |
|
||||||||||||||| | |||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||| |||| | ||||| |
|
|
| T |
4724334 |
gggtttttgaaatcga-ctgaccctttcgggtttt-gaaattgaaccacatcaaaacggccacaaatcttctgccacccaatctcaagtcaa-accaaaa |
4724238 |
T |
 |
| Q |
169 |
gcaaacaaacatgtaccaaaca |
190 |
Q |
| |
|
| |||||||| |||||||||| |
|
|
| T |
4724237 |
gtgaacaaacacgtaccaaaca |
4724216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 86 - 123
Target Start/End: Original strand, 39711775 - 39711812
Alignment:
| Q |
86 |
cagaccctttcgggtttttgaaattgaaccacatcaaa |
123 |
Q |
| |
|
||||||||||||||||| ||||| |||||||||||||| |
|
|
| T |
39711775 |
cagaccctttcgggtttatgaaactgaaccacatcaaa |
39711812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 31; Significance: 0.00000004; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 86 - 124
Target Start/End: Original strand, 21481205 - 21481243
Alignment:
| Q |
86 |
cagaccctttcgggtttttgaaattgaaccacatcaaaa |
124 |
Q |
| |
|
|||||||||||| |||||||||| ||||||||||||||| |
|
|
| T |
21481205 |
cagaccctttcgagtttttgaaactgaaccacatcaaaa |
21481243 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University