View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7178_low_15 (Length: 293)
Name: NF7178_low_15
Description: NF7178
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7178_low_15 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 247; Significance: 1e-137; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 247; E-Value: 1e-137
Query Start/End: Original strand, 17 - 275
Target Start/End: Original strand, 25813928 - 25814186
Alignment:
| Q |
17 |
acatcattaactgagttgtggtttcaaaagaaactctacaaatgcagacatatgattcgtgaggctataaattctgatggatactgggtactaagaagat |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||| |
|
|
| T |
25813928 |
acatcattaactgagttgtggtttcaaaagaaactctacaaatgcagacatatgattcgtgaggctattaattctgatggatactgagtactaagaagat |
25814027 |
T |
 |
| Q |
117 |
cgtggccaaataatttggtatactcaaaggtatgtgttgatcaatttgaagcatgcaaagaaccacaactaaagaaaggtctttggtgggcgaattcaga |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
25814028 |
cgtggccaaataatttggtatactcaaaggtatgtgttgatcaatttgaagcatgcaaagaacaacaactaaagaaaggtctttggtgggcgaattcaga |
25814127 |
T |
 |
| Q |
217 |
tgaggactacgaattcgacacttgcattaattgtcgtcttgacttggaagtggattggt |
275 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25814128 |
tgaggactacgaattcgacacttgcattaattgtcgtcttgacttggaagtggattggt |
25814186 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University