View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7178_low_16 (Length: 264)
Name: NF7178_low_16
Description: NF7178
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7178_low_16 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 110; Significance: 2e-55; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 19 - 245
Target Start/End: Original strand, 4738702 - 4738923
Alignment:
| Q |
19 |
taacttgtaact-gcgttgatcgtctctttctttcaattcttctatttaaaacatgtaatcaatcatctttttcaaacgtgttttaaaacatgcnnnnnn |
117 |
Q |
| |
|
|||||||||||| || ||||||| ||||||||||||||||||||||||||||| ||| |||| ||||||| ||||||||||||||||||| |
|
|
| T |
4738702 |
taacttgtaacttgctttgatcgcctctttctttcaattcttctatttaaaacttgtgatca----tctttttgaaacgtgttttaaaacatgtttttct |
4738797 |
T |
 |
| Q |
118 |
nnctttcaaaagaaacattatatacaattttataaacaaataatgtcaaaaaccttattgaaactccctcnnnnnnngggttttcaccatattcaataaa |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
4738798 |
t--tttcaaaagaaacattatatacaattttataaataaataatgtcaaaaaccttattcaaactccctctttttttgggttttcaccatattcaataaa |
4738895 |
T |
 |
| Q |
218 |
attatcgttcttgatttatttgaacatt |
245 |
Q |
| |
|
| |||| ||||||||||||||||||||| |
|
|
| T |
4738896 |
aatatcattcttgatttatttgaacatt |
4738923 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University