View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7178_low_18 (Length: 261)
Name: NF7178_low_18
Description: NF7178
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7178_low_18 |
 |  |
|
| [»] scaffold0050 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0050 (Bit Score: 156; Significance: 6e-83; HSPs: 1)
Name: scaffold0050
Description:
Target: scaffold0050; HSP #1
Raw Score: 156; E-Value: 6e-83
Query Start/End: Original strand, 22 - 246
Target Start/End: Original strand, 62788 - 63012
Alignment:
| Q |
22 |
cctaaccaatcataaacatcaatccaaatatgacgaaaacagtcgcagtgaagnnnnnnntgaaccgtgtcctccatatgaccacaacctcccacgcaag |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
62788 |
cctaaccaatcataaacatcaatccaaatatgacgaaaccagtcgcagtgaagaaaaagatgaaccgtgtcctccatatgaccacaacctcccacgcaag |
62887 |
T |
 |
| Q |
122 |
atcgagcactagctggaatcataaccctcttaaacaaattgtatttcattgaaaggcgatgcgaagtaaacgccacacaaaaagattaacattcagagga |
221 |
Q |
| |
|
|| ||| ||||| |||||||||| |||||| || ||||||| ||| ||||||||||||||||||||||||| |||||||||||||||||||| |||||| |
|
|
| T |
62888 |
attgagtactagttggaatcatagtcctcttgaataaattgtcttttattgaaaggcgatgcgaagtaaacgtcacacaaaaagattaacattaagagga |
62987 |
T |
 |
| Q |
222 |
acgtctcaaagcctgattatatgat |
246 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
62988 |
acgtctcaaagcctgattatatgat |
63012 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University