View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7178_low_23 (Length: 245)
Name: NF7178_low_23
Description: NF7178
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7178_low_23 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 1 - 237
Target Start/End: Original strand, 36606338 - 36606574
Alignment:
| Q |
1 |
actgttggcacgtgatcccacaatttcagtgtgattaaaactcccatgttcagggggtgttggttcactcaagtcaataaaagtgtttgcgaagtcaaaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
36606338 |
actgttggcacgtgatcccacaatttcagtgtgattaaaactcccatgttcagggggtgttggttcactcaagtcaataaaagtgtttgcaaagtcaaaa |
36606437 |
T |
 |
| Q |
101 |
agttcaaatccttgaatggagactgaagatgaaacagaattgttgctggttgcttgcattcctttggtactactttcaaaagccttcaaaggctctctag |
200 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
36606438 |
agttcaaatccttgaatagagactgaagatgaaacaga---gttgctggttgcttgcattcctttggtactactttcaaaagccttcaaaggctctttag |
36606534 |
T |
 |
| Q |
201 |
aaacatgtggcagatga---ttaggtaaccgatgatgtcc |
237 |
Q |
| |
|
||||||||||||||||| ||||| |||||||||||||| |
|
|
| T |
36606535 |
aaacatgtggcagatgaccgttaggcaaccgatgatgtcc |
36606574 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University