View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7179_high_17 (Length: 415)
Name: NF7179_high_17
Description: NF7179
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7179_high_17 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 372; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 372; E-Value: 0
Query Start/End: Original strand, 8 - 398
Target Start/End: Complemental strand, 25858948 - 25858557
Alignment:
| Q |
8 |
ccgcgccaacataagccgacaacatggaattataagaaaccaaatctctatcaacggcagagtcaaaaaccgctcgtgcttgtgtcaagttttgtgcttt |
107 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25858948 |
ccgcaccaacataagccgacaacatggaattataagaaaccaaatctctatcaacggcagagtcaaaaaccgctcgtgcttgtgtcaagttttgtgcttt |
25858849 |
T |
|
| Q |
108 |
tatgtaagccatagtaagggcattccaagagtatgcatttgggtggggaatttcatcgaacagtttgtgggcatcttttaaaagaccatgtttggaataa |
207 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25858848 |
tatgtaagccataataagggcattccaagagtatgcatttgggtggggaatttcatcgaacagtttgtgggcatcttttaaaagaccatgtttggaataa |
25858749 |
T |
|
| Q |
208 |
aggtgaatgagttgattacaagtgaaaatacttgatgtgaaaccagattttattgcttgaacatggtcacggtatacaactaaatctctcactattatag |
307 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25858748 |
aggtgaatgagttgattacaagtgaaaatacttgatgtgaaaccagattttattgcttgaacatggtcacggtatacaactaaatctctcactattatag |
25858649 |
T |
|
| Q |
308 |
acttcattg-tattgcaatctatggcaatggctattgcttaagattaaaaacaccaattgtaaataagaatttaattggccataacggttac |
398 |
Q |
| |
|
|| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25858648 |
acctcattgatattgcaatctatggcaatggctattgcttaagattaaaaacaccaattgtaaataagaatttaattggccataacggttac |
25858557 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University