View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7179_high_30 (Length: 302)
Name: NF7179_high_30
Description: NF7179
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7179_high_30 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 98; Significance: 3e-48; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 98; E-Value: 3e-48
Query Start/End: Original strand, 22 - 127
Target Start/End: Complemental strand, 25981141 - 25981036
Alignment:
| Q |
22 |
ccccatggaaagaacatttgagatgacgtctctttttggaatgtattccggtcatgttccctcccaatccatcaatgatccgccatgttcctctttttcc |
121 |
Q |
| |
|
|||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25981141 |
ccccatggaaggaccatttgagatgacgtctctttttggaatgtattccggtcatgttccctcccaatccatcaatgatccgccatgttcctctttttcc |
25981042 |
T |
|
| Q |
122 |
attttc |
127 |
Q |
| |
|
|||||| |
|
|
| T |
25981041 |
attttc |
25981036 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University