View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7179_high_35 (Length: 259)
Name: NF7179_high_35
Description: NF7179
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7179_high_35 |
 | |
|
| [»] scaffold0007 (3 HSPs) |
| | |
|
Alignment Details
Target: scaffold0007 (Bit Score: 63; Significance: 2e-27; HSPs: 3)
Name: scaffold0007
Description:
Target: scaffold0007; HSP #1
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 14 - 80
Target Start/End: Complemental strand, 31184 - 31118
Alignment:
| Q |
14 |
tgagaagaaatggcatatggtactattcattgaatatgatgttgttaacgagttatggttagttcag |
80 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31184 |
tgagaagatatggcatatggtactattcattgaatatgatgttgttaacgagttatggttagttcag |
31118 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0007; HSP #2
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 14 - 80
Target Start/End: Complemental strand, 66526 - 66460
Alignment:
| Q |
14 |
tgagaagaaatggcatatggtactattcattgaatatgatgttgttaacgagttatggttagttcag |
80 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
66526 |
tgagaagatatggcatatggtactattcattgaatatgaagttgttaacgagttatggttagttcag |
66460 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0007; HSP #3
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 201 - 240
Target Start/End: Complemental strand, 30999 - 30960
Alignment:
| Q |
201 |
ctagaagattgatcacaagtaatcttaagttcgataagga |
240 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
30999 |
ctagaagattgatcacaagtaatcttaagtttgataagga |
30960 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University