View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7179_high_36 (Length: 257)
Name: NF7179_high_36
Description: NF7179
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7179_high_36 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 21 - 246
Target Start/End: Complemental strand, 45564361 - 45564136
Alignment:
| Q |
21 |
cacgccgccgctgaatctccgatttcagcttacatgcgcgatctgcagaatttctgctccaccatcgattccaaaggcttctctggtttttctcctttgc |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45564361 |
cacgccgccgctgaatctccgatttcagcttacatgcgcgatctgcagaatttctgctccaccatcgattccaaaggcttctctggtttttctcctttgc |
45564262 |
T |
 |
| Q |
121 |
ctcttcctactgttttaccacctcaaccagaacagcaacaacagcaagagaatcaaccgccaccgcagcaggaagttgtgccgccgccaccaccaccggc |
220 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45564261 |
ctcttcctactgttttaccacctcaaccagaacagcaacaacagcaagaaaatcaaccgccaccgcagcaggaagttgtgccgccgccaccaccaccggc |
45564162 |
T |
 |
| Q |
221 |
gacggtggctcactcgacttcttcat |
246 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
45564161 |
gacggtggctcactcgacttcttcat |
45564136 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University