View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7179_high_51 (Length: 212)
Name: NF7179_high_51
Description: NF7179
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7179_high_51 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 16 - 197
Target Start/End: Complemental strand, 38952057 - 38951875
Alignment:
| Q |
16 |
cagagaccgtgattgttaaatgaagtagctaattgaaaatctttcttcatgaatcttt-gcatgctgtgcataatttataaggaagaagcgtggacgaca |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38952057 |
cagagaccgtgattgttaaatgaagtagctaattgaaaatctttcttcatgaatcttttgcatgctgtgcataatttataaggaagaagcgtggacgaca |
38951958 |
T |
 |
| Q |
115 |
agaaataaagccatggtcccctcaccactgattccagctaatagcacgtaggcaagaattgcaatgcagacaatcatgctctt |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38951957 |
agaaataaagccatggtcccctcaccactgattccagctaatagcacgtaggcaagaattgcaatgcagacaatcatgctctt |
38951875 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University