View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7179_high_53 (Length: 207)
Name: NF7179_high_53
Description: NF7179
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7179_high_53 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 168; Significance: 3e-90; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 17 - 188
Target Start/End: Complemental strand, 7175333 - 7175162
Alignment:
| Q |
17 |
aatattgcatgatttcaaatttcaatgtttgagtgattgggagtgtggcatgcacaaaaagagccaaataaggactttcaaatacgttgtttcacataat |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
7175333 |
aatattgcatgatttcaaatttcaatgtttgagtgattgggagtgtggcatgcacaaaaagagccaaataaggactttcaaatatgttgtttcacataat |
7175234 |
T |
 |
| Q |
117 |
atcgaaaggattttcgaatatgttgtttcacataatgtcaagggattacatatcgacatccaatgtgatatc |
188 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7175233 |
atcgaaaggattttcgaatatgttgtttcacataatgtcaagggattacatatcgacatccaatgtgatatc |
7175162 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University