View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7179_high_54 (Length: 207)

Name: NF7179_high_54
Description: NF7179
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7179_high_54
NF7179_high_54
[»] chr4 (1 HSPs)
chr4 (16-189)||(3102040-3102207)


Alignment Details
Target: chr4 (Bit Score: 143; Significance: 3e-75; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 16 - 189
Target Start/End: Original strand, 3102040 - 3102207
Alignment:
16 gaagcgtgagtagaaaatttaaccatttgtgtcaatccaaatccaaatagtgtttgatttagcacaaaattagttattattaattactattcatttcaat 115  Q
    |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||      ||||| ||||||||||    
3102040 gaagcgtgagtagaaaatttaaccatttgtgtcaatccaaatccaaatggtgtttgatttagcacaaaattagttatt------tactagtcatttcaat 3102133  T
116 tagttaggcttgcttgccatatcagaagttagttataaatttgttattaaaagtttagttagttattcctttaa 189  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
3102134 tagttaggcttgcttgccatatcagaagttagttataaatttgttattaaaagtttagttagttattcctttaa 3102207  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University