View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7179_low_23 (Length: 395)
Name: NF7179_low_23
Description: NF7179
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7179_low_23 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 21 - 67
Target Start/End: Complemental strand, 6398543 - 6398497
Alignment:
| Q |
21 |
taagtcatacaacaatgactcgtagtgttcctttccttctgttgacg |
67 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
6398543 |
taagtcatacaacaatgactcgtagtgttcctttacttctgttgacg |
6398497 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University