View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7179_low_43 (Length: 244)
Name: NF7179_low_43
Description: NF7179
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7179_low_43 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 143; Significance: 3e-75; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 51 - 230
Target Start/End: Original strand, 11492299 - 11492482
Alignment:
| Q |
51 |
ttaaacacatgcaaatctttatgttttgaaatttctgaaaatttatggggattactcatcaaaccattttgtaatatcagagaaataatcttgtttctat |
150 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||| |
|
|
| T |
11492299 |
ttaaacacacgcaaatctttatgttttgaaatttctgaaaatttatggggattactcatcaaaccattttgtaatataagagaaataatcttgtttttat |
11492398 |
T |
 |
| Q |
151 |
caaaaacaaaaacat----atacctctaatcattggtttccggcatccaaagggatcatccacgatatcttcatctcacaggtt |
230 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
11492399 |
caaaaacaaaaacatatacatacctctaatcattggttgccgacatccaaagggatcatccacgatatcttcatctcaccggtt |
11492482 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 174 - 216
Target Start/End: Complemental strand, 39343066 - 39343024
Alignment:
| Q |
174 |
aatcattggtttccggcatccaaagggatcatccacgatatct |
216 |
Q |
| |
|
||||| ||||| ||||||||||||||||||||||| ||||||| |
|
|
| T |
39343066 |
aatcactggttgccggcatccaaagggatcatccatgatatct |
39343024 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University