View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7179_low_47 (Length: 236)
Name: NF7179_low_47
Description: NF7179
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7179_low_47 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 1 - 229
Target Start/End: Original strand, 25254148 - 25254379
Alignment:
| Q |
1 |
aagacataaaaagaagaaaaaatatatataagaacgaatctaacttcgtcaacaccaaacagcatacttagcaaacaatccnnnnnnnnn---ggcttac |
97 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
25254148 |
aagacataaaaagaagaaaaagtatatataagaacgaatctaacttcgtccacaccaaacagcatacttagcaaacaatccaaaaaaaaaaaaggcttac |
25254247 |
T |
 |
| Q |
98 |
ttgattatagtatgttggcatccatgtaagaagaatgaaagttccccagttgtggcaaaagtgggacacaatcagggcccagactggtggtttcgacaaa |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
25254248 |
ttgattatagtatgttggcatccatgtaagaagaatgaaagttccccagttgtggcaaaagtgggacacaatcagggcccagaccggtggtttcgacaaa |
25254347 |
T |
 |
| Q |
198 |
attaatccccaaggtatttccttcacaggttc |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
25254348 |
attaatccccaaggtatttccttcacaggttc |
25254379 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University