View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7179_low_49 (Length: 229)
Name: NF7179_low_49
Description: NF7179
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7179_low_49 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 14 - 215
Target Start/End: Complemental strand, 50519554 - 50519354
Alignment:
| Q |
14 |
atcaagtagtaggtccaaccgaaaatatcttatcaagaagcaaacnnnnnnntttgagtcaccattgagatnnnnnnngtaataatattattcattctca |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
50519554 |
atcaagtagtaggtccaaccgaaaatatcttatcaagaagcaaacaaaaaaatttgagtcaccattgagataaaaaa-gtaataatattattcattctca |
50519456 |
T |
 |
| Q |
114 |
cgcaacttgttattttttacattttagtaatgtacatcgcaaaaagataggtatgtgatgggttgggtatctcatatttgtttcttagtttgttaagata |
213 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50519455 |
cgcaacttgttattttttgcattttagtaatgtacatcgcaaaaagataggtacgtgatgggttgggtatctcatatttgtttcttagtttgttaagata |
50519356 |
T |
 |
| Q |
214 |
tt |
215 |
Q |
| |
|
|| |
|
|
| T |
50519355 |
tt |
50519354 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 168 - 204
Target Start/End: Complemental strand, 10781701 - 10781665
Alignment:
| Q |
168 |
gtgatgggttgggtatctcatatttgtttcttagttt |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||| |
|
|
| T |
10781701 |
gtgatgggttgggtatctcatatttgtttctttgttt |
10781665 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University