View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7179_low_55 (Length: 207)

Name: NF7179_low_55
Description: NF7179
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7179_low_55
NF7179_low_55
[»] chr6 (1 HSPs)
chr6 (17-188)||(7175162-7175333)


Alignment Details
Target: chr6 (Bit Score: 168; Significance: 3e-90; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 17 - 188
Target Start/End: Complemental strand, 7175333 - 7175162
Alignment:
17 aatattgcatgatttcaaatttcaatgtttgagtgattgggagtgtggcatgcacaaaaagagccaaataaggactttcaaatacgttgtttcacataat 116  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||    
7175333 aatattgcatgatttcaaatttcaatgtttgagtgattgggagtgtggcatgcacaaaaagagccaaataaggactttcaaatatgttgtttcacataat 7175234  T
117 atcgaaaggattttcgaatatgttgtttcacataatgtcaagggattacatatcgacatccaatgtgatatc 188  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
7175233 atcgaaaggattttcgaatatgttgtttcacataatgtcaagggattacatatcgacatccaatgtgatatc 7175162  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University