View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7180_low_18 (Length: 251)
Name: NF7180_low_18
Description: NF7180
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7180_low_18 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 14 - 230
Target Start/End: Complemental strand, 19243311 - 19243094
Alignment:
| Q |
14 |
atcaacttatgatccgttacctgagcaccccatcctaaacctagggagaatattgctgatggtgctgaccatgatccatctgattttctcgaaacaacca |
113 |
Q |
| |
|
||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19243311 |
atcaacttatgattcattacctgagcaccccatcctaaacctagggagaatattgctgatggtgctgaccatgatccatctgattttctcgaaacaacca |
19243212 |
T |
 |
| Q |
114 |
aaccagtacccagtttgtatgagagcaatgcaccggccttgacaactgttaaaattgctaggcctttggcttccttaagaatggct-aaggaattgactt |
212 |
Q |
| |
|
||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||| |
|
|
| T |
19243211 |
aaccagtacccagtttgtatgagagaaatgcaccagccttgacaactgttaaaattgctaggcctttggcttccttaagaatggctaaagggattgactt |
19243112 |
T |
 |
| Q |
213 |
ctcaggattggacctggc |
230 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
19243111 |
ctcaggattggacctggc |
19243094 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 61; Significance: 3e-26; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 31 - 179
Target Start/End: Original strand, 51597073 - 51597221
Alignment:
| Q |
31 |
tacctgagcaccccatcctaaacctagggagaatattgctgatggtgctgaccatgatccatctgattttctcgaaacaaccaaaccagtacccagtttg |
130 |
Q |
| |
|
|||||||||||||||||||||||| | |||| |||| ||||||||||| |||||||||||||| || ||| | ||||||||||||||||| | |||| |
|
|
| T |
51597073 |
tacctgagcaccccatcctaaacccatggagcatatagctgatggtgcagaccatgatccatcatatcttcgagctacaaccaaaccagtaccaactttg |
51597172 |
T |
 |
| Q |
131 |
tatgagagcaatgcaccggccttgacaactgttaaaattgctaggcctt |
179 |
Q |
| |
|
|| |||| || || || || ||||||||||||||||||||||| |||| |
|
|
| T |
51597173 |
taagagaccagagcgccagctttgacaactgttaaaattgctagacctt |
51597221 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University