View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7180_low_18 (Length: 251)

Name: NF7180_low_18
Description: NF7180
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7180_low_18
NF7180_low_18
[»] chr2 (1 HSPs)
chr2 (14-230)||(19243094-19243311)
[»] chr4 (1 HSPs)
chr4 (31-179)||(51597073-51597221)


Alignment Details
Target: chr2 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 14 - 230
Target Start/End: Complemental strand, 19243311 - 19243094
Alignment:
14 atcaacttatgatccgttacctgagcaccccatcctaaacctagggagaatattgctgatggtgctgaccatgatccatctgattttctcgaaacaacca 113  Q
    ||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
19243311 atcaacttatgattcattacctgagcaccccatcctaaacctagggagaatattgctgatggtgctgaccatgatccatctgattttctcgaaacaacca 19243212  T
114 aaccagtacccagtttgtatgagagcaatgcaccggccttgacaactgttaaaattgctaggcctttggcttccttaagaatggct-aaggaattgactt 212  Q
    ||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||    
19243211 aaccagtacccagtttgtatgagagaaatgcaccagccttgacaactgttaaaattgctaggcctttggcttccttaagaatggctaaagggattgactt 19243112  T
213 ctcaggattggacctggc 230  Q
    ||||||||||||||||||    
19243111 ctcaggattggacctggc 19243094  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 61; Significance: 3e-26; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 31 - 179
Target Start/End: Original strand, 51597073 - 51597221
Alignment:
31 tacctgagcaccccatcctaaacctagggagaatattgctgatggtgctgaccatgatccatctgattttctcgaaacaaccaaaccagtacccagtttg 130  Q
    |||||||||||||||||||||||| | |||| |||| ||||||||||| ||||||||||||||  || |||  |  ||||||||||||||||| | ||||    
51597073 tacctgagcaccccatcctaaacccatggagcatatagctgatggtgcagaccatgatccatcatatcttcgagctacaaccaaaccagtaccaactttg 51597172  T
131 tatgagagcaatgcaccggccttgacaactgttaaaattgctaggcctt 179  Q
    || |||| ||  || || || ||||||||||||||||||||||| ||||    
51597173 taagagaccagagcgccagctttgacaactgttaaaattgctagacctt 51597221  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University