View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7180_low_3 (Length: 463)
Name: NF7180_low_3
Description: NF7180
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7180_low_3 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 239; Significance: 1e-132; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 164 - 443
Target Start/End: Original strand, 42239654 - 42239935
Alignment:
| Q |
164 |
gagcgttcgattttgatcggatagtctagattggttgaatacaatgtatggtatccaaattcaatgagag--tatatatgtgaattgaaaatgaattatt |
261 |
Q |
| |
|
||||||||||||||||||| |||||||||||| ||||||||||||| |||||||||||||| |||||||| ||||| |||||||||||||||||||||| |
|
|
| T |
42239654 |
gagcgttcgattttgatcgaatagtctagattcgttgaatacaatgcatggtatccaaattgaatgagagagtatatgtgtgaattgaaaatgaattatt |
42239753 |
T |
|
| Q |
262 |
gtccatgcgcatgcaataaaaggtcggtttagtggaaagtggcaaaattgcatttgctcattttacctagtattttttaaagcaccttttagaccaagat |
361 |
Q |
| |
|
||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42239754 |
gtccatgcgcatgtaataagaggtcggtttagtggaaagtggcaaaattgcatttgctcattttacctagtattttttaaagcaccttttagaccaagat |
42239853 |
T |
|
| Q |
362 |
acaactttactcttgtgaccatatgatatgataaggtgggtgtgcagctaggctttccttttgaactaaactatcaaatatc |
443 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
42239854 |
acaactttactcttgtgaccatatgatatgataaggtgggtgtgcagctaggctttgcttttgaactaaactatcaaatatc |
42239935 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 18 - 101
Target Start/End: Original strand, 42239505 - 42239591
Alignment:
| Q |
18 |
tgtggagtggggaaagaatgataataagagaaagagaaaatctaggttgtgtaggttacatttagatcatc---tcaaaattagacg |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||| | ||||||| ||||| ||| ||||||||||||| |
|
|
| T |
42239505 |
tgtggagtggggaaagaatgataataagagaaagagaaaatctaagttgtgcacgttacatctagattatctgatcaaaattagacg |
42239591 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University