View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7180_low_7 (Length: 354)
Name: NF7180_low_7
Description: NF7180
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7180_low_7 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 297; Significance: 1e-167; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 297; E-Value: 1e-167
Query Start/End: Original strand, 1 - 345
Target Start/End: Original strand, 16160669 - 16161008
Alignment:
| Q |
1 |
ccggttctgttgagagtacttccttggcctttggtgctgaacatgaatctgctttcaaggctaatggatctggtgtcaaaagaaatctttcttctgcctt |
100 |
Q |
| |
|
||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
16160669 |
ccggttctgctgagagtacttccttggccgttggtgctgaacatgaatctgctttcaa-----atggatctggtgccaaaagaaatctttcttctgcctt |
16160763 |
T |
|
| Q |
101 |
tgttgaagttgactctgatgatgagactcttgcctagaaatatggaaggattagaaagggttgaacgtagtggttggttgtcgaactgtctgagttatcg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
16160764 |
tgttgaagttgactctgatgatgagactcttgcccagaaatatggaaggattagaaagggttgaacgcagtggttggttgtcgaactgtctgagttatcg |
16160863 |
T |
|
| Q |
201 |
tttgtaataatggctgcattagtgcatcaattgaaccattgtgtctatgtttgttgttgtttgcttcattttgtttggagatatggactccctcttatgt |
300 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
16160864 |
tttgtagtaatggctgcattagtgcatcaattgaaccattgtgtctatgtttgttgttgtttgcttcattttgtttggagatgtggactccctcttatgt |
16160963 |
T |
|
| Q |
301 |
tgttccttttgaatttttatgttgtgtgtctcttttatgtgatgt |
345 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16160964 |
tgttccttttgaatttttatgttgtgtgtctcttttatgtgatgt |
16161008 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University