View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7182_low_10 (Length: 381)
Name: NF7182_low_10
Description: NF7182
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7182_low_10 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 314; Significance: 1e-177; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 314; E-Value: 1e-177
Query Start/End: Original strand, 22 - 368
Target Start/End: Complemental strand, 31869988 - 31869642
Alignment:
| Q |
22 |
tttgcttgatgttgaaactttaaacatgcatcggggtaatgtagtgtaacgttttaaattgtggtcgcgccatggtccttgatataacagagaattgcac |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31869988 |
tttgcttgatgttgaaactttaaacatgcatcggggtaatgtagtgtaacgttttaaattgtggtcgcgccatggtccttgatataacagagaattgcac |
31869889 |
T |
|
| Q |
122 |
tcaaatgtgaccgatgctatctcaattatagtcacagtaacaacaaaaaccctgatgttgctgcccagatctcagtcacagacttctgtttaaaaccttt |
221 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
31869888 |
tcaaatgcgaccgatgctatctcaattatagtcacagtaacaacaaaaaccctgatgttgctgcccagatctcagtcacaaacttctgtttaaaaccttt |
31869789 |
T |
|
| Q |
222 |
gcagctgcattacatgatgcaatctaaaggtctgctggcaaatgtagtgtaacctttacactgccatttaaaacatcgnnnnnnnttattttttgaagtc |
321 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
31869788 |
gcagctgcattacatgatgcaatctaaaagtctgctggcaaatgtagtgtaacctttacactgccatttaaaacatcgaaaaaaattattttttgaagtc |
31869689 |
T |
|
| Q |
322 |
gatgtttgtggttgagaattattaacactcaaatatcttgctggtct |
368 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31869688 |
gatgtttgtggttgagaattattaacactcaaatatcttgctggtct |
31869642 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University