View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7182_low_14 (Length: 277)
Name: NF7182_low_14
Description: NF7182
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7182_low_14 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 21 - 259
Target Start/End: Original strand, 54303009 - 54303247
Alignment:
| Q |
21 |
tctgctaccactcataaacccctcaaattctacttcacaagtgcaatatcaccgtcaccatcatcttctattattgattgcttgatatcttctgctccga |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
54303009 |
tctgctaccactcataaacccctcaaattctacttcacaagtgcaatatcaccgccaccatcatcttctattattgatcgcttgatatcttctgctccga |
54303108 |
T |
 |
| Q |
121 |
ttcacaaaccattcaatttggaaggaaacttttcctcttcttccgtcaaggatgttgattatccaaccggagattttgatttcattccacactcaggctt |
220 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
54303109 |
ttcacaaaccattcaatttggaaggaaacttttcctcttcttccgtcaaggatgttgattatccaaccggagattttgattccattccacactcaggctt |
54303208 |
T |
 |
| Q |
221 |
gattgaagaagtatctggttaaacttaagactctactag |
259 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
54303209 |
gattgaagaagcatctggttaaacttaagactctactag |
54303247 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University