View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7182_low_6 (Length: 407)
Name: NF7182_low_6
Description: NF7182
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7182_low_6 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 202; Significance: 1e-110; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 153 - 390
Target Start/End: Original strand, 2392232 - 2392469
Alignment:
| Q |
153 |
ttatttttgtaaccttccaatttgaatatcccgccctctatactaatgtaaccttaagctagacatgtcgggccctgttgtatttgcatggccttagacc |
252 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||| ||||||| ||||||||||||||||||||||| |
|
|
| T |
2392232 |
ttatttttgtaaccttccaatttgaatatcccgccctctatactgatgtaaccttatgctagacatgttgggccctcttgtatttgcatggccttagacc |
2392331 |
T |
|
| Q |
253 |
taagtcattttaagaggggggtatcgaggtatatttgatatgatggtcacaacccaggcatgtttgctagctcaagaccgtacaagctattggtgaagtt |
352 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
2392332 |
caagtcattttaagaggggggtatcgaggtatatttgatacgatggtcacaacccaggcatgtttgctagctcaagaccgtacaagcttttggtgaagtt |
2392431 |
T |
|
| Q |
353 |
gcaaacttggttatgatatgcagtagttgaagaataac |
390 |
Q |
| |
|
||||||||| ||| |||||||||||||||||||||||| |
|
|
| T |
2392432 |
gcaaacttgattaagatatgcagtagttgaagaataac |
2392469 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 44 - 115
Target Start/End: Original strand, 2392106 - 2392177
Alignment:
| Q |
44 |
ctatcattggtggtatcattcacgtcaagggcgatatgtccttggtgtttgtaaaagctatccctttatcct |
115 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
2392106 |
ctatcattggtggtattgttcacgtcaagggcgatatgtccttggtgtttgtaaaagtgatccctttatcct |
2392177 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University