View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7184_high_12 (Length: 204)
Name: NF7184_high_12
Description: NF7184
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7184_high_12 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 149; Significance: 7e-79; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 149; E-Value: 7e-79
Query Start/End: Original strand, 19 - 182
Target Start/End: Complemental strand, 8587834 - 8587668
Alignment:
| Q |
19 |
ttttcacacttaactccaattctacctctacaattcgaa---tttccaacgtcgtttttgatggtcctccaaaaatcgcttttttattcctcgttcgtca |
115 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8587834 |
ttttcacacttaactccaattctagctctacaattcgaagaatttccaacgtcgtttttgatggtcctccaaaaatcgcttttttattcctcgttcgtca |
8587735 |
T |
 |
| Q |
116 |
aaatattccccttgattttctctggggtgctttctttcaggttccttcaatttcctctgcctctttt |
182 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8587734 |
aaatattccccttgattttctctggggtgctttctttcaggttccttcaatttcctctgcctctttt |
8587668 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University