View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7184_low_10 (Length: 248)
Name: NF7184_low_10
Description: NF7184
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7184_low_10 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 6 - 231
Target Start/End: Original strand, 29521253 - 29521478
Alignment:
| Q |
6 |
aatgagatggacatcacttttttaaaaatagaagctgacaatcttcatggtccttatgattgagatgataatttgatttatgaatcaaacagatgtgata |
105 |
Q |
| |
|
|||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29521253 |
aatgagatagacatcactttttttaaaatagaagctgacaatcttcatggtccttatgattgagatgataatttgatttatgaatcaaacagatgtgata |
29521352 |
T |
|
| Q |
106 |
agctagcaatctttatcagataaaaattgtcatatatattattatgaaagttataaacactttctatagttattatgaatatctttagggtaaagtcgtt |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
29521353 |
agctagcaatctttatcagataaaaattgtcatatatattattatgaaagttataaacactttctatagttattatgaatatctttagggtaaagttgtt |
29521452 |
T |
|
| Q |
206 |
ttaagtgtcatattattgctttaagt |
231 |
Q |
| |
|
|||||||||||||| ||||||||||| |
|
|
| T |
29521453 |
ttaagtgtcatattgttgctttaagt |
29521478 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University