View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7184_low_13 (Length: 204)

Name: NF7184_low_13
Description: NF7184
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7184_low_13
NF7184_low_13
[»] chr2 (1 HSPs)
chr2 (19-182)||(8587668-8587834)


Alignment Details
Target: chr2 (Bit Score: 149; Significance: 7e-79; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 149; E-Value: 7e-79
Query Start/End: Original strand, 19 - 182
Target Start/End: Complemental strand, 8587834 - 8587668
Alignment:
19 ttttcacacttaactccaattctacctctacaattcgaa---tttccaacgtcgtttttgatggtcctccaaaaatcgcttttttattcctcgttcgtca 115  Q
    |||||||||||||||||||||||| ||||||||||||||   ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
8587834 ttttcacacttaactccaattctagctctacaattcgaagaatttccaacgtcgtttttgatggtcctccaaaaatcgcttttttattcctcgttcgtca 8587735  T
116 aaatattccccttgattttctctggggtgctttctttcaggttccttcaatttcctctgcctctttt 182  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
8587734 aaatattccccttgattttctctggggtgctttctttcaggttccttcaatttcctctgcctctttt 8587668  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University