View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7185_high_2 (Length: 286)
Name: NF7185_high_2
Description: NF7185
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7185_high_2 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 113; Significance: 3e-57; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 113; E-Value: 3e-57
Query Start/End: Original strand, 69 - 213
Target Start/End: Complemental strand, 40545374 - 40545229
Alignment:
| Q |
69 |
cccacttactttatgaatctttaactctannnnnnn-gttgattaattctattcttactctttctttaaagtttggtgtttaatttcgttcttatacaca |
167 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
40545374 |
cccacttactttatgaatctttaactctattttttttgttgattaattctattcttactctttctttaaagtttggtgtttaatttcgttcttatacaaa |
40545275 |
T |
 |
| Q |
168 |
aatctaattcttttaagaataaaacaaaatatatttagatcatttt |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40545274 |
aatctaattcttttaagaataaaacaaaatatatttagatcatttt |
40545229 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 210 - 256
Target Start/End: Complemental strand, 40545169 - 40545123
Alignment:
| Q |
210 |
ttttactgatgtagtttattcattaatgatgtgacaacgttataatg |
256 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40545169 |
ttttactgatgtagtttattcattaatgatgtgacaacgttataatg |
40545123 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University