View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7185_low_1 (Length: 215)
Name: NF7185_low_1
Description: NF7185
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7185_low_1 |
 | |
|
| [»] scaffold0179 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0179 (Bit Score: 156; Significance: 5e-83; HSPs: 1)
Name: scaffold0179
Description:
Target: scaffold0179; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 11 - 201
Target Start/End: Original strand, 1992 - 2182
Alignment:
| Q |
11 |
acatcaactgcttccaatttctctctaaaccttggcagcaacataagaaaaaatgaattatgctgtatatactcaagaaaaacttacagactagttgata |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1992 |
acatcaactgcttccaatttctctctaaaccttggcagcaacataagaaaaaatgaattatgctgtatatactcaagaaaaacttacagactagttgata |
2091 |
T |
|
| Q |
111 |
accatgttgtatatactcatcacaaccctctagtttctctgtaacttaatggccgcaagnnnnnnnnntggagagtttttattgtctgtga |
201 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||| |
|
|
| T |
2092 |
accaagttgtatatactcatcacaaccctctagtttctctgtaacttaatggccgcaagaaaaaaaaatggacagtttttattgtctgtga |
2182 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University