View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7185_low_4 (Length: 215)
Name: NF7185_low_4
Description: NF7185
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7185_low_4 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 182; Significance: 1e-98; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 182; E-Value: 1e-98
Query Start/End: Original strand, 18 - 199
Target Start/End: Original strand, 2572883 - 2573064
Alignment:
| Q |
18 |
gtatcaaagtttctattctattatcttaacttgagtcatggtggggctgaacaagatgttaagattgagacaattaaggttgtaatcgatcttctttcat |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2572883 |
gtatcaaagtttctattctattatcttaacttgagtcatggtggggctgaacaagatgttaagattgagacaattaaggttgtaatcgatcttctttcat |
2572982 |
T |
|
| Q |
118 |
tgcttgatattggatcaatttcttgcaaggatttgttcaatcttaatcgaattgctattagtttgaaaataagcaaattttg |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2572983 |
tgcttgatattggatcaatttcttgcaaggatttgttcaatcttaatcgaattgctattagtttgaaaataagcaaattttg |
2573064 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University