View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7185_low_5 (Length: 212)
Name: NF7185_low_5
Description: NF7185
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7185_low_5 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 16 - 204
Target Start/End: Complemental strand, 52930249 - 52930061
Alignment:
| Q |
16 |
atgatgataacgacctttcttctgattttgaggtatgttatgaattgaacaataagttgtttatccaaatatatccttaatttctgatttgtctgaatcc |
115 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
52930249 |
atgataataacgacctttcttctgattttgaggtatgttatgaattgaacaataagttgtttatccaaatctatccttaatttctgatttgtctgaatcc |
52930150 |
T |
|
| Q |
116 |
atttgtttgttaggatgtgaatgtacaatctgatgatgacggcaacaatattattggaattaagaggaatgaaattgtttctgatgatg |
204 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52930149 |
atttgtttgttaggatgtgaatgtacaatctgatgatgacggcaacaatattattggaattaagaggaatgaaattgtttctgatgatg |
52930061 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 33; Significance: 0.000000001; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 102 - 156
Target Start/End: Complemental strand, 44371629 - 44371571
Alignment:
| Q |
102 |
atttgtctgaatc---catttgtttgtt-aggatgtgaatgtacaatctgatgatgacg |
156 |
Q |
| |
|
||||||||||||| |||||||||||| |||||| ||||||||||||||||||||||| |
|
|
| T |
44371629 |
atttgtctgaatcattcatttgtttgtttaggatgagaatgtacaatctgatgatgacg |
44371571 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 102 - 156
Target Start/End: Complemental strand, 44380484 - 44380426
Alignment:
| Q |
102 |
atttgtctgaatc---catttgtttgtt-aggatgtgaatgtacaatctgatgatgacg |
156 |
Q |
| |
|
||||||||||||| |||||||||||| |||||| ||||||||||||||||||||||| |
|
|
| T |
44380484 |
atttgtctgaatcattcatttgtttgtttaggatgagaatgtacaatctgatgatgacg |
44380426 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University