View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7186_high_15 (Length: 226)
Name: NF7186_high_15
Description: NF7186
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7186_high_15 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 15 - 209
Target Start/End: Complemental strand, 26152093 - 26151899
Alignment:
| Q |
15 |
aatattaaacatcggcggcgtgttcacataaaaatgcaaccggcgcaaatcctccctcgtatacataaaccaagcaatcaccgatgcagccgagaattca |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26152093 |
aatattaaacatcggcggcgtgttcacataaaaatgcaaccggcgcaaatcctccctcgtatacataaaccaagcaatcaccgatgcagccgagaattca |
26151994 |
T |
|
| Q |
115 |
tgaacatcatccattttaatggttaaacaccgcaatgccttagtttgaaaaattgtttgagtgataattatttccaacgtactggatgataattc |
209 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26151993 |
tgaacatcatccattttaatcgttaaacaccgcaatgccttggtttgaaaaattgtttgagtgataattatttccaacgtactggatgataattc |
26151899 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University