View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7186_high_7 (Length: 310)
Name: NF7186_high_7
Description: NF7186
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7186_high_7 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 67; Significance: 9e-30; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 67; E-Value: 9e-30
Query Start/End: Original strand, 192 - 294
Target Start/End: Original strand, 7908579 - 7908680
Alignment:
| Q |
192 |
ctcatttgaaatttttattttataagtaacatgtcaatgtttgnnnnnnnnngtagtttgcgaagtcatgtgcaggtgtggtagagtttctaccttctct |
291 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7908579 |
ctcatttgaaatttttattttataagtaacatgtcaatgttcgaaaaaaaa-gtagtttgcgaagtcatgtgcaggtgtggtagagtttctaccttctct |
7908677 |
T |
|
| Q |
292 |
tct |
294 |
Q |
| |
|
||| |
|
|
| T |
7908678 |
tct |
7908680 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University