View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7186_high_9 (Length: 270)
Name: NF7186_high_9
Description: NF7186
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7186_high_9 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 21 - 259
Target Start/End: Original strand, 52863974 - 52864212
Alignment:
| Q |
21 |
aattagccggaaaacacagtgaccaggccaacctggccatctcttctcggattcagattcatccgtaggatttgcggcggcgtcaaagattgtatatgat |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
52863974 |
aattagccggaaaacacagtgaccaggccaacctggccatctcttctcggattcagattcatccgtaggattcgcggcggcgtcaaagattgtatatgat |
52864073 |
T |
 |
| Q |
121 |
tctgattgaagagtgccgtttggaattggctctaccgccgtggccatatgaaaagggtttagagaggcgtaggcgtagttctcaagatcgaagtcaagta |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
52864074 |
tctgattgaagagtgccgtttggaattggctctaccgccgtggccatatgaaaagggtttagagaggcgtaggcgtagttctgaagatcgaagtcaagta |
52864173 |
T |
 |
| Q |
221 |
acttcaaaacttaaccagttaatcttgctgtctgtctct |
259 |
Q |
| |
|
|||| ||||||||||||||||| |||||||||||||||| |
|
|
| T |
52864174 |
acttaaaaacttaaccagttaaccttgctgtctgtctct |
52864212 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University