View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7186_low_13 (Length: 250)
Name: NF7186_low_13
Description: NF7186
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7186_low_13 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 98; Significance: 2e-48; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 145 - 246
Target Start/End: Complemental strand, 7908568 - 7908467
Alignment:
| Q |
145 |
tttgatactcactgattcatgacttgagataaacggacctgcagaatgttttggagacatttcactctatcctccgctatttgcatatcatctctgatac |
244 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
7908568 |
tttgatactcactgattcatgacttgagataaacggacctgcagaatgttttggagacatttcactatatcctccgctatttgcatatcatctctgatac |
7908469 |
T |
 |
| Q |
245 |
tt |
246 |
Q |
| |
|
|| |
|
|
| T |
7908468 |
tt |
7908467 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University