View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7186_low_14 (Length: 240)
Name: NF7186_low_14
Description: NF7186
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7186_low_14 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 1 - 216
Target Start/End: Original strand, 43886798 - 43887013
Alignment:
| Q |
1 |
cttggtggagatccaatgaaatatggaggcgacgatgccaacaaattagccgctgccgatctctctggatagcagcttgcctgcaaacaaatcaaatcaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||| || |
|
|
| T |
43886798 |
cttggtggagatccaatgaaatatggaggcgacgatgccaacaaattagccgctgccgatctctctggatagcaacttgcctgtaaacaaatcaaataaa |
43886897 |
T |
|
| Q |
101 |
atacgaactattaggatagactctttaaaaaagatacaattcatagactttgataatataaattatcaccaaaatttgagtatcacaagatatcaacatg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
43886898 |
atacgaactattaggatagactctttaaaaaagataaaattcatagactttgataatataaattatcaccaaaatttgagtatcaaaagatatcaacatg |
43886997 |
T |
|
| Q |
201 |
aactattaggcaaaat |
216 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
43886998 |
aactattaggcaaaat |
43887013 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University