View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7187_low_1 (Length: 231)
Name: NF7187_low_1
Description: NF7187
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7187_low_1 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 1 - 213
Target Start/End: Original strand, 17772090 - 17772302
Alignment:
| Q |
1 |
cgaatactgtcacggttgatgataatatcgaggatgataagtatggtttgaatgagccagtgacgaacatggcttctgttggtatgaaacatgagaatga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17772090 |
cgaatactgtcacggttgatgataatatcgaggatgataagtatggtttgaatgagccagtgacgaacatggcttctgttggtatgaaacatgagaatga |
17772189 |
T |
 |
| Q |
101 |
agatagaagtatctcagatggtcctgaatcaaaaccgattgcagcggttcatgagatgccagagcagcaaacaagctgtgataatggtttggaattgagt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17772190 |
agatagaagtatctcagatggtcctgaatcaaaaccgattgcagcggttcatgagatgccagagcagcaaacaagctgtgataatggtttggaattgagt |
17772289 |
T |
 |
| Q |
201 |
aatactcctcttt |
213 |
Q |
| |
|
||||||||||||| |
|
|
| T |
17772290 |
aatactcctcttt |
17772302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University