View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7189_low_1 (Length: 225)
Name: NF7189_low_1
Description: NF7189
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7189_low_1 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 2 - 225
Target Start/End: Original strand, 9242140 - 9242363
Alignment:
| Q |
2 |
taccaatattgtcatgttacatgcctatctttttatttaattcacattcaaactagacatgatgtatagttcaatcaatagtttattgcatgaaaaggac |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
9242140 |
taccaatattgtcatgttacatgcctatctttttatttaattcacattcaaactagacatgatgtatagttcaatcaatagtttattgcatgaaaatgac |
9242239 |
T |
|
| Q |
102 |
atttgttgttagttacacattacattttcagctaaaatttgttgcattttgttaaccatgaaaattcctattctcattttatggaaaaataaattggacc |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
9242240 |
atttgttgttagttacacattacattttcagctaaaatttgttgcattttgttaaccatgaaaattcctattctcattttatggaaaaataaattggatc |
9242339 |
T |
|
| Q |
202 |
taatctcattttagagagtatatt |
225 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
9242340 |
taatctcattttagagagtatatt |
9242363 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University