View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7189_low_2 (Length: 211)
Name: NF7189_low_2
Description: NF7189
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7189_low_2 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 173; Significance: 3e-93; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 173; E-Value: 3e-93
Query Start/End: Original strand, 1 - 189
Target Start/End: Complemental strand, 38566831 - 38566643
Alignment:
| Q |
1 |
caatgatccagttaggatgatgtggtgcatattggcgagcagctgtgttagcttgtgttttgcctccatttctcttaggataacccttgattttgaagca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38566831 |
caatgatccagttaggatgatgtggtgcatattggcgagcagctgtgttagcttctgttttgcctccatttctcttaggataacccttgattttgaagca |
38566732 |
T |
 |
| Q |
101 |
atttcttgcagtatgattaggtctgtttaggctgatgttgttggccgcaggatctcgttgctgcatttggagtaacaactagagaatat |
189 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||| |
|
|
| T |
38566731 |
atttcttgcagtatgattaggtctgttttggctgatgttgttggccgcaggatcttgttgctgcatttgcagtaacaactagagaatat |
38566643 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University