View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7191_high_12 (Length: 328)
Name: NF7191_high_12
Description: NF7191
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7191_high_12 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 238; Significance: 1e-132; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 1 - 268
Target Start/End: Complemental strand, 23692263 - 23691997
Alignment:
| Q |
1 |
gcagtgtagaaaattcggtttgagtttgttactaa-ggttatttaaacaaaaatagggaaatgttctaccataatattttatcaaatatctcttgatttt |
99 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23692263 |
gcagtgtagacaattcggtttgagtttgttactaaaggttatttaaacaaaaatagggaaatgttctaccataatattttatcaaatatctcttgatttt |
23692164 |
T |
 |
| Q |
100 |
tggaaatttgtagttatgttacacatatacaagtacaactctatattatgctcccatccttaagatctactattgttcatgatggcttagcttattttat |
199 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23692163 |
tggaaatttgtagttatgttacatatatacaagtacaactctat--tatgctcccatccttaagatctactattgttcatgatggcttagcttattttat |
23692066 |
T |
 |
| Q |
200 |
tttatttcaaaaatactaacaattaatccatcaagaaaactcaaaggtaaacaattaatgggaccaaag |
268 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23692065 |
tttatttcaaaaatactaataattaatccatcaagaaaactcaaaggtaaacaattaatgggaccaaag |
23691997 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University