View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7191_high_15 (Length: 298)
Name: NF7191_high_15
Description: NF7191
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7191_high_15 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 139; Significance: 9e-73; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 139; E-Value: 9e-73
Query Start/End: Original strand, 8 - 168
Target Start/End: Complemental strand, 30952976 - 30952817
Alignment:
| Q |
8 |
gagagaga-agaacagaagttcaacatgattgaagcaatggagaacacccagaaagaagaatagcgttctgtgtttgatcctcccttcccttctatccat |
106 |
Q |
| |
|
|||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
30952976 |
gagagagagagaagagaagttcaacatgattgaagcaatggagaacacccagaaagaagaatagcgtt--gtgtttgatcctcccttcccttctatccat |
30952879 |
T |
 |
| Q |
107 |
ggtattaagtttgttagatgtgtgtgttgggtagcaagaaattagccacaaatgttgggtag |
168 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30952878 |
ggtattaagtttgttagatgtgtgtgttgggtagcaagaaattagccacaaatgttgggtag |
30952817 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University