View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7191_low_16 (Length: 279)
Name: NF7191_low_16
Description: NF7191
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7191_low_16 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 176; Significance: 7e-95; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 176; E-Value: 7e-95
Query Start/End: Original strand, 73 - 263
Target Start/End: Original strand, 46424992 - 46425183
Alignment:
| Q |
73 |
gggggtccaaatcttggatacatttatgtaagtgggttgaatccatcttatcttacagtaacaactaacttcaagttagaatccattctggagacaaagt |
172 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46424992 |
gggggtccaaatcttggatacatttatgtaagtgggttgaatccatcttatcttatagtaacaactaacttcaagttagaatccattctggagacaaagt |
46425091 |
T |
|
| Q |
173 |
caacccta-ctagagcatatccattcgcacaagtttaatcaaattctacacttatgaatgcaataaatacattgaaaagtgaaagaaacaat |
263 |
Q |
| |
|
|||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46425092 |
caaccctacctagagcatatccatccgcacaagtttaatcaaattctacacttatgaatgcaataaatacattgaaaagtgaaagaaacaat |
46425183 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 36 - 72
Target Start/End: Original strand, 46424936 - 46424972
Alignment:
| Q |
36 |
gaccgataattcaggatcaatacagtcgtccaccagc |
72 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46424936 |
gaccgataattcaggatcaatacagtcgtccaccagc |
46424972 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University